human ace2 coding sequence (Sino Biological)
Sino Biological is a verified supplier 
Sino Biological manufactures this product 
96
Structured Review
Sino Biological
human ace2 coding sequence
Human Ace2 Coding Sequence, supplied by Sino Biological, used in various techniques. Bioz Stars score: 96/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+ace2+coding+sequence/Human+ACE2+%2F+Angiotensin-Converting+Enzyme+2+Gene+ORF+cDNA+clone+in+cloning+vector/pm34354120-189-16-20
Average 96 stars, based on 11 article reviews
Human Ace2 Coding Sequence, supplied by Sino Biological, used in various techniques. Bioz Stars score: 96/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+ace2+coding+sequence/Human+ACE2+%2F+Angiotensin-Converting+Enzyme+2+Gene+ORF+cDNA+clone+in+cloning+vector/pm34354120-189-16-20
Average 96 stars, based on 11 article reviews
human ace2 coding sequence - by Bioz Stars,
2026-10
96/100 stars
Images
Related Articles
Over Expression:Article Title: ACE2 protein expression within isogenic cell lines is heterogeneous and associated with distinct transcriptomes Article Snippet: CRISPR constructs were generated by cloning an ACE2 -targeting gRNA sequence [TACCAAGCAAATGAGCAGGG] or a nontargeting control gRNA sequence [CGTGTGTGGGTAAACGGAAA] into Esp3I (New England Biolabs, Ipswich MA) sites of the pLentiCRISPRv2 backbone (Addgene, Watertown MA, #52961, gifted by Feng Zhang). .. An ACE2 overexpression construct was generated by HiFi DNA assembly (New England Biolabs #E2621) of the Article Title: ACE2 protein expression within isogenic cell lines is heterogeneous and associated with distinct transcriptomes. Article Snippet: CRISPR constructs were generated by cloning an ACE2-targeting gRNA sequence [TAC CAA GCA AAT GAG CAG GG] or a nontargeting control gRNA sequence [CGT GTG TGG GTA AAC GGA AA] into Esp3I (New England Biolabs, Ipswich MA) sites of the pLentiCRISPRv2 backbone (Addgene, Watertown MA, #52961, gifted by Feng Zhang). .. An ACE2 overexpression construct was generated by HiFi DNA assembly (New England Biolabs #E2621) of the Article Title: ACE2 protein expression within isogenic cell lines is heterogeneous and associated with distinct transcriptomes Article Snippet: CRISPR constructs were generated by cloning an ACE2 -targeting gRNA sequence [TACCAAGCAAATGAGCAGGG] or a nontargeting control gRNA sequence [CGTGTGTGGGTAAACGGAAA] into Esp3I (New England Biolabs, Ipswich MA) sites of the pLentiCRISPRv2 backbone (Addgene, Watertown MA, #52961, gifted by Feng Zhang). .. An ACE2 overexpression construct was generated by HiFi DNA assembly (New England Biolabs #E2621) of the Construct:Article Title: ACE2 protein expression within isogenic cell lines is heterogeneous and associated with distinct transcriptomes Article Snippet: CRISPR constructs were generated by cloning an ACE2 -targeting gRNA sequence [TACCAAGCAAATGAGCAGGG] or a nontargeting control gRNA sequence [CGTGTGTGGGTAAACGGAAA] into Esp3I (New England Biolabs, Ipswich MA) sites of the pLentiCRISPRv2 backbone (Addgene, Watertown MA, #52961, gifted by Feng Zhang). .. An ACE2 overexpression construct was generated by HiFi DNA assembly (New England Biolabs #E2621) of the Article Title: ACE2 protein expression within isogenic cell lines is heterogeneous and associated with distinct transcriptomes. Article Snippet: CRISPR constructs were generated by cloning an ACE2-targeting gRNA sequence [TAC CAA GCA AAT GAG CAG GG] or a nontargeting control gRNA sequence [CGT GTG TGG GTA AAC GGA AA] into Esp3I (New England Biolabs, Ipswich MA) sites of the pLentiCRISPRv2 backbone (Addgene, Watertown MA, #52961, gifted by Feng Zhang). .. An ACE2 overexpression construct was generated by HiFi DNA assembly (New England Biolabs #E2621) of the Article Title: ACE2 protein expression within isogenic cell lines is heterogeneous and associated with distinct transcriptomes Article Snippet: CRISPR constructs were generated by cloning an ACE2 -targeting gRNA sequence [TACCAAGCAAATGAGCAGGG] or a nontargeting control gRNA sequence [CGTGTGTGGGTAAACGGAAA] into Esp3I (New England Biolabs, Ipswich MA) sites of the pLentiCRISPRv2 backbone (Addgene, Watertown MA, #52961, gifted by Feng Zhang). .. An ACE2 overexpression construct was generated by HiFi DNA assembly (New England Biolabs #E2621) of the Generated:Article Title: ACE2 protein expression within isogenic cell lines is heterogeneous and associated with distinct transcriptomes Article Snippet: CRISPR constructs were generated by cloning an ACE2 -targeting gRNA sequence [TACCAAGCAAATGAGCAGGG] or a nontargeting control gRNA sequence [CGTGTGTGGGTAAACGGAAA] into Esp3I (New England Biolabs, Ipswich MA) sites of the pLentiCRISPRv2 backbone (Addgene, Watertown MA, #52961, gifted by Feng Zhang). .. An ACE2 overexpression construct was generated by HiFi DNA assembly (New England Biolabs #E2621) of the Article Title: ACE2 protein expression within isogenic cell lines is heterogeneous and associated with distinct transcriptomes. Article Snippet: CRISPR constructs were generated by cloning an ACE2-targeting gRNA sequence [TAC CAA GCA AAT GAG CAG GG] or a nontargeting control gRNA sequence [CGT GTG TGG GTA AAC GGA AA] into Esp3I (New England Biolabs, Ipswich MA) sites of the pLentiCRISPRv2 backbone (Addgene, Watertown MA, #52961, gifted by Feng Zhang). .. An ACE2 overexpression construct was generated by HiFi DNA assembly (New England Biolabs #E2621) of the Article Title: ACE2 protein expression within isogenic cell lines is heterogeneous and associated with distinct transcriptomes Article Snippet: CRISPR constructs were generated by cloning an ACE2 -targeting gRNA sequence [TACCAAGCAAATGAGCAGGG] or a nontargeting control gRNA sequence [CGTGTGTGGGTAAACGGAAA] into Esp3I (New England Biolabs, Ipswich MA) sites of the pLentiCRISPRv2 backbone (Addgene, Watertown MA, #52961, gifted by Feng Zhang). .. An ACE2 overexpression construct was generated by HiFi DNA assembly (New England Biolabs #E2621) of the Sequencing:Article Title: ACE2 protein expression within isogenic cell lines is heterogeneous and associated with distinct transcriptomes Article Snippet: CRISPR constructs were generated by cloning an ACE2 -targeting gRNA sequence [TACCAAGCAAATGAGCAGGG] or a nontargeting control gRNA sequence [CGTGTGTGGGTAAACGGAAA] into Esp3I (New England Biolabs, Ipswich MA) sites of the pLentiCRISPRv2 backbone (Addgene, Watertown MA, #52961, gifted by Feng Zhang). .. An ACE2 overexpression construct was generated by HiFi DNA assembly (New England Biolabs #E2621) of the Article Title: ACE2 protein expression within isogenic cell lines is heterogeneous and associated with distinct transcriptomes. Article Snippet: CRISPR constructs were generated by cloning an ACE2-targeting gRNA sequence [TAC CAA GCA AAT GAG CAG GG] or a nontargeting control gRNA sequence [CGT GTG TGG GTA AAC GGA AA] into Esp3I (New England Biolabs, Ipswich MA) sites of the pLentiCRISPRv2 backbone (Addgene, Watertown MA, #52961, gifted by Feng Zhang). .. An ACE2 overexpression construct was generated by HiFi DNA assembly (New England Biolabs #E2621) of the Article Title: ACE2 protein expression within isogenic cell lines is heterogeneous and associated with distinct transcriptomes Article Snippet: CRISPR constructs were generated by cloning an ACE2 -targeting gRNA sequence [TACCAAGCAAATGAGCAGGG] or a nontargeting control gRNA sequence [CGTGTGTGGGTAAACGGAAA] into Esp3I (New England Biolabs, Ipswich MA) sites of the pLentiCRISPRv2 backbone (Addgene, Watertown MA, #52961, gifted by Feng Zhang). .. An ACE2 overexpression construct was generated by HiFi DNA assembly (New England Biolabs #E2621) of the |